[LeetCode] 264. Ugly Number II

轉自LeetCode

Write a program to find the n-th ugly number.

Ugly numbers are positive numbers whose prime factors only include 2, 3, 5. For example, 1, 2, 3, 4, 5, 6, 8, 9, 10, 12 is the sequence of the first 10 ugly numbers.

Note that 1 is typically treated as an ugly number, and n does not exceed 1690.

<Solution>

[LeetCode] 263. Ugly Number

轉自LeetCode

Write a program to check whether a given number is an ugly number.

Ugly numbers are positive numbers whose prime factors only include 2, 3, 5. For example, 6, 8 are ugly while 14 is not ugly since it includes another prime factor 7.

Note that 1 is typically treated as an ugly number.

<Solution>

[LeetCode] 258. Add Digits

轉自LeetCode

Given a non-negative integer num, repeatedly add all its digits until the result has only one digit.

For example:

Given num = 38, the process is like: 3 + 8 = 11, 1 + 1 = 2. Since 2 has only one digit, return it.

Follow up:
Could you do it without any loop/recursion in O(1) runtime?

<Solution>

[LeetCode] 202. Happy Number

轉自LeetCode

Write an algorithm to determine if a number is "happy".

A happy number is a number defined by the following process: Starting with any positive integer, replace the number by the sum of the squares of its digits, and repeat the process until the number equals 1 (where it will stay), or it loops endlessly in a cycle which does not include 1. Those numbers for which this process ends in 1 are happy numbers.

Example: 19 is a happy number

• 12 + 92 = 82
• 82 + 22 = 68
• 62 + 82 = 100
• 12 + 02 + 02 = 1

<Solution>

[LeetCode] 201. Bitwise AND of Numbers Range

轉自LeetCode

Given a range [m, n] where 0 <= m <= n <= 2147483647, return the bitwise AND of all numbers in this range, inclusive.

For example, given the range [5, 7], you should return 4.

<Solution>

[LeetCode] 200. Number of Islands

轉自LeetCode

Given a 2d grid map of '1's (land) and '0's (water), count the number of islands. An island is surrounded by water and is formed by connecting adjacent lands horizontally or vertically. You may assume all four edges of the grid are all surrounded by water.

Example 1:

11110
11010
11000
00000

Answer: 1

Example 2:

11000
11000
00100
00011

Answer: 3

<Solution>

[LeetCode] 454. 4Sum II

轉自LeetCode

Given four lists A, B, C, D of integer values, compute how many tuples (i, j, k, l) there are such that A[i] + B[j] + C[k] + D[l] is zero.

To make problem a bit easier, all A, B, C, D have same length of N where 0 ≤ N ≤ 500. All integers are in the range of -228 to 228 - 1 and the result is guaranteed to be at most 231 - 1.

Example:

Input:
A = [ 1, 2]
B = [-2,-1]
C = [-1, 2]
D = [ 0, 2]

Output:
2

Explanation:
The two tuples are:
1. (0, 0, 0, 1) -> A[0] + B[0] + C[0] + D[1] = 1 + (-2) + (-1) + 2 = 0
2. (1, 1, 0, 0) -> A[1] + B[1] + C[0] + D[0] = 2 + (-1) + (-1) + 0 = 0

<Solution>

[LeetCode] 199. Binary Tree Right Side View

轉自LeetCode

Given a binary tree, imagine yourself standing on the right side of it, return the values of the nodes you can see ordered from top to bottom.

For example:
Given the following binary tree,

   1            <---
 /   \
2     3         <---
 \     \
  5     4       <---

You should return [1, 3, 4].

<Solution>

[LeetCode] 238. Product of Array Except Self

轉自LeetCode

Given an array of n integers where n > 1, nums, return an array output such that output[i] is equal to the product of all the elements of nums except nums[i].

Solve it without division and in O(n).

For example, given [1,2,3,4], return [24,12,8,6].

Follow up:
Could you solve it with constant space complexity? (Note: The output array does not count as extra space for the purpose of space complexity analysis.)

<Solution>

[LeetCode] 152. Maximum Product Subarray

轉自LeetCode

Find the contiguous subarray within an array (containing at least one number) which has the largest product.

For example, given the array [2,3,-2,4],
the contiguous subarray [2,3] has the largest product = 6.

<Solution>

[LeetCode] 198. House Robber

轉自LeetCode

You are a professional robber planning to rob houses along a street. Each house has a certain amount of money stashed, the only constraint stopping you from robbing each of them is that adjacent houses have security system connected and it will automatically contact the police if two adjacent houses were broken into on the same night.

Given a list of non-negative integers representing the amount of money of each house, determine the maximum amount of money you can rob tonight without alerting the police.

<Solution>

[LeetCode] 461. Hamming Distance

轉自LeetCode

The Hamming distance between two integers is the number of positions at which the corresponding bits are different.

Given two integers x and y, calculate the Hamming distance.

Note:
0 ≤ x, y < 231.

Example:

Input: x = 1, y = 4

Output: 2

Explanation:
1   (0 0 0 1)
4   (0 1 0 0)
       ↑   ↑

The above arrows point to positions where the corresponding bits are different.

<Solution>

[LeetCode] 401. Binary Watch

轉自LeetCode

A binary watch has 4 LEDs on the top which represent the hours (0-11), and the 6 LEDs on the bottom represent the minutes (0-59).

Each LED represents a zero or one, with the least significant bit on the right.

For example, the above binary watch reads "3:25".

Given a non-negative integer n which represents the number of LEDs that are currently on, return all possible times the watch could represent.

Example:

Input: n = 1
Return: ["1:00", "2:00", "4:00", "8:00", "0:01", "0:02", "0:04", "0:08", "0:16", "0:32"]

Note:

• The order of output does not matter.
• The hour must not contain a leading zero, for example "01:00" is not valid, it should be "1:00".
• The minute must be consist of two digits and may contain a leading zero, for example "10:2" is not valid, it should be "10:02".

<Solution>

[LeetCode] 338. Counting Bits

轉自LeetCode

Given a non negative integer number num. For every numbers i in the range 0 ≤ i ≤ num calculate the number of 1's in their binary representation and return them as an array.

Example:
For num = 5 you should return [0,1,1,2,1,2].

Follow up:

• It is very easy to come up with a solution with run time O(n*sizeof(integer)). But can you do it in linear time O(n) /possibly in a single pass?
• Space complexity should be O(n).
• Can you do it like a boss? Do it without using any builtin function like __builtin_popcount in c++ or in any other language.

<Solution>

[LeetCode] 342. Power of Four

轉自LeetCode

Given an integer (signed 32 bits), write a function to check whether it is a power of 4.

Example:
Given num = 16, return true. Given num = 5, return false.

Follow up: Could you solve it without loops/recursion?

<Solution>

[LeetCode] 326. Power of Three

轉自LeetCode

Given an integer, write a function to determine if it is a power of three.

Follow up:
Could you do it without using any loop / recursion?

<Solution>

[LeetCode] 231. Power of Two

轉自LeetCode

Given an integer, write a function to determine if it is a power of two.

<Solution>

[LeetCode] 191. Number of 1 Bits

轉自LeetCode

Write a function that takes an unsigned integer and returns the number of ’1' bits it has (also known as the Hamming weight).

For example, the 32-bit integer ’11' has binary representation 00000000000000000000000000001011, so the function should return 3.

<Solution>

[LeetCode] 190. Reverse Bits

轉自LeetCode

Reverse bits of a given 32 bits unsigned integer.

For example, given input 43261596 (represented in binary as 00000010100101000001111010011100), return 964176192 (represented in binary as 00111001011110000010100101000000).

<Solution>

[LeetCode] 187. Repeated DNA Sequences

轉自LeetCode

All DNA is composed of a series of nucleotides abbreviated as A, C, G, and T, for example: "ACGAATTCCG". When studying DNA, it is sometimes useful to identify repeated sequences within the DNA.

Write a function to find all the 10-letter-long sequences (substrings) that occur more than once in a DNA molecule.

For example,

Given s = "AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT",

Return:
["AAAAACCCCC", "CCCCCAAAAA"].

<Solution>